CD Skripsi

Analisis Penanda Genetik Berdasarkan Gen Sitokrom b Pada Ikan Wallago leeri (BLEEKER 1851) Dari Sungai Kampar Provinsi Riau

---

Kampar river is one of the floodplain river in Riau Province. One of the fauna that lives in the Kampar rivers is Wallago leeri. This fish widely consumed and liked. The are arrest that occur continuously it possibly could cause the population decreasing and this endemic species destroyed in the future. The aim of the research is to study of Cytochrome b gen mitochodrial DNA as molecular different of this species and can be used to support the genetic conservation of W. leeri. Before having genetic information, total DNA isolation and amplification is necessary to be carried out. The result of DNA isolation were amplified using the PCR (Polymerase Chain Reaction) technique with primers universal of L14841 (F) 5’AAAGCTTCCATCCAACATCTCAGCATGATGAAA3’ and H15149 (R) 5’AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA3’. The result of multiple alligment were 326 Nucleotide (coding 108 amino acids). The result show 16 different sites for genus, one site for differentianting species and one site for differentianting habitate. The amino acid sites find one site for differentianting genus.
Key word : Kampar river, floodplain, W. leeri, Cytochrome b, site

---

Ketersediaan

Informasi Detail

Judul Seri

-

No. Panggil

03 04.119 (0062)

Penerbit

Pekanbaru : Universitas Riau – FMIPA – Biologi., 2019

Deskripsi Fisik

xiii, 38 hlm.: ill.: 29 cm

Bahasa

Indonesia

ISBN/ISSN

-

Klasifikasi

03 04.119 (0062)

Tipe Isi

-

Tipe Media

-

Tipe Pembawa

-

Edisi

-

Subjek

-

Info Detail Spesifik

-

Pernyataan Tanggungjawab

JAKA

Versi lain/terkait

Lampiran Berkas

Komentar

---

Anda harus masuk sebelum memberikan komentar