CD Skripsi
Penanda Genetik Ikan Tapah (Wallago Leeri) (Bleeker 1851) Asal Sungai Kampar Provinsi Riau Menggunakan D-Loop Dna Mitokondria
Kampar River is a large river associated with several tributaries. One of the fauna that lives on the Kampar River is Wallago leerii. This fish has a high economic value. This study aims to study the use of mitochondrial DNA D-Loop sequences as genetic differentiaters as the identity and source of genetic information of W. leeri fish. Before obtaining scientific information genetically, it is necessary to isolate and amplify DNA. The result of total DNA isolation is applied with PCR (Polymerase Chain Reaction) technique using specific primer CTRG1 (Forward) 5'AAGCACCGGTCTTGTAATCC3' and CTRG2 (Reverse) 5'GCCTTTAAATGAACGCCTTG3'. The results of multiple alignment were 625 pb nucleotides. The result show 35 different sites for genus, differentiating sites and two differentiating species.
Keywords : Kampar river, W. leerii, D-Loop, Site
Tidak tersedia versi lain